Review



gene name gene/unigene id  (Unigene)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Unigene gene name gene/unigene id
    Gene Name Gene/Unigene Id, supplied by Unigene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene name gene/unigene id/product/Unigene
    Average 90 stars, based on 1 article reviews
    gene name gene/unigene id - by Bioz Stars, 2026-06
    90/100 stars

    Images



    Similar Products

    strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id  (ATCC)
    90
    ATCC strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id
    Strain Gene Name Accession Polypeptide Arthrobacter Aurescens Dsm Hyuc Seq Id, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id/product/ATCC
    Average 90 stars, based on 1 article reviews
    strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    name sequence source repository persistent id url human akap12 hakap12 hg18215 ut sino biologicals  (Sino Biological)
    92
    Sino Biological name sequence source repository persistent id url human akap12 hakap12 hg18215 ut sino biologicals
    Name Sequence Source Repository Persistent Id Url Human Akap12 Hakap12 Hg18215 Ut Sino Biologicals, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/name sequence source repository persistent id url human akap12 hakap12 hg18215 ut sino biologicals/product/Sino Biological
    Average 92 stars, based on 1 article reviews
    name sequence source repository persistent id url human akap12 hakap12 hg18215 ut sino biologicals - by Bioz Stars, 2026-06
    92/100 stars
    		  Buy from Supplier
    oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10)  (Oligos Etc)
    90
    Oligos Etc oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10)
    Oligo Gene Name Sequence (5’ 3’) Gyra Gyra For Ttgaaggaggaactcttgatgg (Seq Id No: 10), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10)/product/Oligos Etc
    Average 90 stars, based on 1 article reviews
    oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10) - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    protein mapping to uniprot ids and gene names  (SomaLogic)
    90
    SomaLogic protein mapping to uniprot ids and gene names
    Protein Mapping To Uniprot Ids And Gene Names, supplied by SomaLogic, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/protein mapping to uniprot ids and gene names/product/SomaLogic
    Average 90 stars, based on 1 article reviews
    protein mapping to uniprot ids and gene names - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    gene ncbi gene id target sequence grna1 target sequence grna2 vector name source fn1 2335 actgacccccttcatg gcagcgg plenti crispr v2 gfp  (Addgene inc)
    97
    Addgene inc gene ncbi gene id target sequence grna1 target sequence grna2 vector name source fn1 2335 actgacccccttcatg gcagcgg plenti crispr v2 gfp
    Gene Ncbi Gene Id Target Sequence Grna1 Target Sequence Grna2 Vector Name Source Fn1 2335 Actgacccccttcatg Gcagcgg Plenti Crispr V2 Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene ncbi gene id target sequence grna1 target sequence grna2 vector name source fn1 2335 actgacccccttcatg gcagcgg plenti crispr v2 gfp/product/Addgene inc
    Average 97 stars, based on 1 article reviews
    gene ncbi gene id target sequence grna1 target sequence grna2 vector name source fn1 2335 actgacccccttcatg gcagcgg plenti crispr v2 gfp - by Bioz Stars, 2026-06
    97/100 stars
    		  Buy from Supplier
    work organism strain gene name glycoconjugate uniprot id fasta expression strain predicted udp sugar substrate e71 ssn campylobacter  (ATCC)
    94
    ATCC work organism strain gene name glycoconjugate uniprot id fasta expression strain predicted udp sugar substrate e71 ssn campylobacter
    Work Organism Strain Gene Name Glycoconjugate Uniprot Id Fasta Expression Strain Predicted Udp Sugar Substrate E71 Ssn Campylobacter, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/work organism strain gene name glycoconjugate uniprot id fasta expression strain predicted udp sugar substrate e71 ssn campylobacter/product/ATCC
    Average 94 stars, based on 1 article reviews
    work organism strain gene name glycoconjugate uniprot id fasta expression strain predicted udp sugar substrate e71 ssn campylobacter - by Bioz Stars, 2026-06
    94/100 stars
    		  Buy from Supplier
    pfam id and gene name  (InterPro Inc)
    90
    InterPro Inc pfam id and gene name
    Pfam Id And Gene Name, supplied by InterPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pfam id and gene name/product/InterPro Inc
    Average 90 stars, based on 1 article reviews
    pfam id and gene name - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    gene name gene/unigene id  (Unigene)
    90
    Unigene gene name gene/unigene id
    Gene Name Gene/Unigene Id, supplied by Unigene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene name gene/unigene id/product/Unigene
    Average 90 stars, based on 1 article reviews
    gene name gene/unigene id - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    name gene id description score srxn1 ensp00000371388  (Proteintech)
    92
    Proteintech name gene id description score srxn1 ensp00000371388
    Name Gene Id Description Score Srxn1 Ensp00000371388, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/name gene id description score srxn1 ensp00000371388/product/Proteintech
    Average 92 stars, based on 1 article reviews
    name gene id description score srxn1 ensp00000371388 - by Bioz Stars, 2026-06
    92/100 stars
    		  Buy from Supplier
    gene name gene id log2fc p value annotation chromosome chrom_start chrom_end  (Chrom Tech)
    90
    Chrom Tech gene name gene id log2fc p value annotation chromosome chrom_start chrom_end
    Gene Name Gene Id Log2fc P Value Annotation Chromosome Chrom Start Chrom End, supplied by Chrom Tech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene name gene id log2fc p value annotation chromosome chrom_start chrom_end/product/Chrom Tech
    Average 90 stars, based on 1 article reviews
    gene name gene id log2fc p value annotation chromosome chrom_start chrom_end - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier

    Image Search Results